Cherry SNP DataBase

SNP information

Name Pav_sc0001557.1_15060R
Chr PAV_r1.0chr7
Pos (Chr) 7608399
PAV_r1.0 Pav_sc0001557.1
Pos (PAV_r1.0) 15060
REF G
ALT A
SSR motif
Gene Name Pav_sc0001557.1_g070.1.mk
Annotation PREDICTED: cell division cycle 20.1, cofactor of APC complex-like
snpEff Effect 3_prime_UTR_variant
Impact MODIFIER
Codon c.*391G>A
Amino Acid
PCR Forward primer AGTGCTTACACGAACAGCGA
Reverse primer GCACCAACAGCTCCACATTA
Product size 329
Enzymes for CAPS MspI
Exp. fragment size (REF) 236,93
Exp. fragment size (ALT) 329
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF ALT/ALT REF/ALT REF/REF REF/ALT REF/ALT REF/ALT


| Top |