Cherry SNP DataBase

SNP information

Name Pav_sc0001580.1_120321R
Chr PAV_r1.0chr3
Pos (Chr) 1920133
PAV_r1.0 Pav_sc0001580.1
Pos (PAV_r1.0) 120321
REF A
ALT G
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.120321A>G
Amino Acid
PCR Forward primer AACCCAGAAATTCACGCATC
Reverse primer AAGTATGGCATCCAACAGGG
Product size 208
Enzymes for CAPS BglII | MboI
Exp. fragment size (REF) 208 | 208
Exp. fragment size (ALT) 91,117 | 91,117
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF ALT/ALT REF/ALT REF/ALT REF/REF REF/ALT


| Top |