Cherry SNP DataBase

SNP information

Name Pav_sc0001608.1_15232R
Chr PAV_r1.0chr8
Pos (Chr) 20210680
PAV_r1.0 Pav_sc0001608.1
Pos (PAV_r1.0) 15232
REF G
ALT A
SSR motif
Gene Name Pav_sc0001608.1_g030.1.mk
Annotation PREDICTED: uncharacterized protein LOC103333959
snpEff Effect intron_variant
Impact MODIFIER
Codon c.973+132G>A
Amino Acid
PCR Forward primer CTCGTCTGTTGTTTTGGGGT
Reverse primer CTGGTGATGCCACCTACCTT
Product size 293
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/ALT REF/REF REF/REF REF/ALT REF/ALT


| Top |