Cherry SNP DataBase

SNP information

Name Pav_sc0001687.1_92792K
Chr PAV_r1.0chr6
Pos (Chr) 18801745
PAV_r1.0 Pav_sc0001687.1
Pos (PAV_r1.0) 92792
REF T
ALT G
SSR motif
Gene Name Pav_sc0001687.1_g200.1.mk
Annotation PREDICTED: BTB/POZ domain-containing protein At3g09030
snpEff Effect missense_variant
Impact MODERATE
Codon c.1239T>G
Amino Acid p.Ile413Met
PCR Forward primer GCACTTTCAGGTTCCATCGT
Reverse primer AGGTCAAGCGAAGAAGTGGA
Product size 212
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/ALT REF/ALT REF/REF REF/ALT


| Top |