Cherry SNP DataBase

SNP information

Name Pav_sc0001699.1_186073R
Chr PAV_r1.0chr6
Pos (Chr) 20605823
PAV_r1.0 Pav_sc0001699.1
Pos (PAV_r1.0) 186073
REF A
ALT G
SSR motif
Gene Name Pav_sc0001699.1_g620.1.mk
Annotation PREDICTED: mediator of RNA polymerase II transcription subunit 33A-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1051+42T>C
Amino Acid
PCR Forward primer TGGAGCGTCAAAATTCCTTC
Reverse primer TGCAATTCTGGATTTGGTCA
Product size 312
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/ALT REF/REF REF/REF REF/REF REF/REF


| Top |