Cherry SNP DataBase

SNP information

Name Pav_sc0001710.1_360978K
Chr PAV_r1.0chr3
Pos (Chr) 4588272
PAV_r1.0 Pav_sc0001710.1
Pos (PAV_r1.0) 360978
REF T
ALT G
SSR motif
Gene Name Pav_sc0001710.1_g740.1.mk
Annotation PREDICTED: uncharacterized protein LOC103327947 isoform X1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.817-174T>G
Amino Acid
PCR Forward primer GCAAACTGGAGAGTGCACAA
Reverse primer GGCACTTGAAACCTGCAAAT
Product size 344
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/REF REF/ALT REF/REF REF/REF


| Top |