Cherry SNP DataBase

SNP information

Name Pav_sc0001710.1_693057K
Chr PAV_r1.0chr3
Pos (Chr) 4256193
PAV_r1.0 Pav_sc0001710.1
Pos (PAV_r1.0) 693057
REF T
ALT G
SSR motif
Gene Name Pav_sc0001710.1_g1360.1.mk
Annotation PREDICTED: golgin candidate 5 isoform X1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.2581-438T>G
Amino Acid
PCR Forward primer TCTCTCTCTCTCTCTCTATTGCATTG
Reverse primer GAGGAAAATTGTGCTTCAAATG
Product size 342
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT ALT/ALT REF/REF REF/ALT REF/ALT REF/ALT REF/ALT


| Top |