Cherry SNP DataBase

SNP information

Name Pav_sc0001734.1_42212Y
Chr PAV_r1.0chr3
Pos (Chr) 6690452
PAV_r1.0 Pav_sc0001734.1
Pos (PAV_r1.0) 42212
REF T
ALT C
SSR motif
Gene Name Pav_sc0001734.1_g110.1.mk
Annotation PREDICTED: protein TOPLESS
snpEff Effect synonymous_variant
Impact LOW
Codon c.1692A>G
Amino Acid p.Ala564Ala
PCR Forward primer CACTTCTGTCAGCCAGACCA
Reverse primer GTCTCTTGGCTGTTTCTGCC
Product size 298
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT


| Top |