Cherry SNP DataBase

SNP information

Name Pav_sc0001772.1_26208R
Chr PAV_r1.0chr5
Pos (Chr) 1618464
PAV_r1.0 Pav_sc0001772.1
Pos (PAV_r1.0) 26208
REF G
ALT A
SSR motif
Gene Name Pav_sc0001772.1_g020.1.mk
Annotation PREDICTED: uncharacterized protein LOC103336700
snpEff Effect intron_variant
Impact MODIFIER
Codon c.132-510C>T
Amino Acid
PCR Forward primer TGGTTTACGTGGATCTCAAGC
Reverse primer TCATCGACTGCAGATGAAAAG
Product size 298
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/REF REF/ALT ALT/ALT ALT/ALT REF/ALT


| Top |