Cherry SNP DataBase

SNP information

Name Pav_sc0001786.1_100524W
Chr PAV_r1.0chr4
Pos (Chr) 26302350
PAV_r1.0 Pav_sc0001786.1
Pos (PAV_r1.0) 100524
REF T
ALT A
SSR motif
Gene Name Pav_sc0001786.1_g210.1.mk
Annotation PREDICTED: exocyst complex component SEC6
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1135-36T>A
Amino Acid
PCR Forward primer ATTGCGAGAAGGCATACCAC
Reverse primer TGGGAGCAGTGCAGTAGTTG
Product size 336
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT ALT/ALT REF/ALT REF/REF REF/REF REF/ALT


| Top |