Cherry SNP DataBase

SNP information

Name Pav_sc0001786.1_55515W
Chr PAV_r1.0chr4
Pos (Chr) 26257341
PAV_r1.0 Pav_sc0001786.1
Pos (PAV_r1.0) 55515
REF T
ALT A
SSR motif
Gene Name Pav_sc0001786.1_g160.1.mk
Annotation PREDICTED: ultraviolet-B receptor UVR8
snpEff Effect intron_variant
Impact MODIFIER
Codon c.840+480T>A
Amino Acid
PCR Forward primer CCCAACTGCTTTAGCTTTCG
Reverse primer ATGCCAACCATGTGTCTGAA
Product size 246
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/REF REF/REF ALT/ALT REF/REF REF/ALT


| Top |