Cherry SNP DataBase

SNP information

Name Pav_sc0001786.1_56186Y
Chr PAV_r1.0chr4
Pos (Chr) 26258012
PAV_r1.0 Pav_sc0001786.1
Pos (PAV_r1.0) 56186
REF T
ALT C
SSR motif
Gene Name Pav_sc0001786.1_g160.1.mk
Annotation PREDICTED: ultraviolet-B receptor UVR8
snpEff Effect intron_variant
Impact MODIFIER
Codon c.841-752T>C
Amino Acid
PCR Forward primer TGTATGCCTGGGACAACTCA
Reverse primer GTTTCACAATGGGGAGCAGT
Product size 338
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT ALT/ALT REF/ALT REF/REF REF/REF REF/ALT


| Top |