Cherry SNP DataBase

SNP information

Name Pav_sc0001794.1_117654W
Chr PAV_r1.0chr6
Pos (Chr) 18399112
PAV_r1.0 Pav_sc0001794.1
Pos (PAV_r1.0) 117654
REF T
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.117654T>A
Amino Acid
PCR Forward primer AAGCAAACGATTTGTGAGGG
Reverse primer AATTGTTGCTGCTTTGCCTT
Product size 303
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT ALT/ALT REF/ALT REF/ALT REF/REF REF/ALT


| Top |