Cherry SNP DataBase

SNP information

Name Pav_sc0001794.1_168739Y
Chr PAV_r1.0chr6
Pos (Chr) 18348027
PAV_r1.0 Pav_sc0001794.1
Pos (PAV_r1.0) 168739
REF C
ALT T
SSR motif
Gene Name Pav_sc0001794.1_g350.1.mk
Annotation PREDICTED: protein NRT1/ PTR FAMILY 5.6
snpEff Effect intron_variant
Impact MODIFIER
Codon c.902+139C>T
Amino Acid
PCR Forward primer AGTCTGCCTCACCCTTCTGA
Reverse primer TCCGAAATGTTATGTTGCCA
Product size 335
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/REF REF/ALT REF/ALT ALT/ALT REF/ALT


| Top |