Cherry SNP DataBase

SNP information

Name Pav_sc0001801.1_346055R
Chr PAV_r1.0chr6
Pos (Chr) 9765909
PAV_r1.0 Pav_sc0001801.1
Pos (PAV_r1.0) 346055
REF A
ALT G
SSR motif
Gene Name Pav_sc0001801.1_g690.1.mk
Annotation PREDICTED: uncharacterized protein At2g27730, mitochondrial
snpEff Effect missense_variant
Impact MODERATE
Codon c.88A>G
Amino Acid p.Thr30Ala
PCR Forward primer TGCAAGGTTTGTTACTCGGA
Reverse primer TTTCAAGTTTCCCCAGACAAA
Product size 281
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/REF REF/ALT -/- -/- REF/ALT


| Top |