Cherry SNP DataBase

SNP information

Name Pav_sc0001836.1_11414Y
Chr PAV_r1.0chr2
Pos (Chr) 4109478
PAV_r1.0 Pav_sc0001836.1
Pos (PAV_r1.0) 11414
REF C
ALT T
SSR motif
Gene Name Pav_sc0001836.1_g030.1.mk
Annotation PREDICTED: ABSCISIC ACID-INSENSITIVE 5-like protein 2
snpEff Effect intron_variant
Impact MODIFIER
Codon c.889-445G>A
Amino Acid
PCR Forward primer GTACACCACGACCCCTGAAT
Reverse primer TTTAGGTTTGGGGAATGGGT
Product size 275
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/ALT REF/ALT ALT/ALT REF/ALT REF/ALT


| Top |