Cherry SNP DataBase

SNP information

Name Pav_sc0001836.1_8219Y
Chr PAV_r1.0chr2
Pos (Chr) 4112673
PAV_r1.0 Pav_sc0001836.1
Pos (PAV_r1.0) 8219
REF C
ALT T
SSR motif
Gene Name Pav_sc0001836.1_g010.1.mk
Annotation PREDICTED: protein argonaute 4A-like
snpEff Effect synonymous_variant
Impact LOW
Codon c.1830C>T
Amino Acid p.Tyr610Tyr
PCR Forward primer CCATGAGCCTGCTTGAATTT
Reverse primer CCATGGCTTGAGGAAGTCTC
Product size 333
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/ALT REF/REF ALT/ALT REF/ALT


| Top |