Cherry SNP DataBase

SNP information

Name Pav_sc0001862.1_38856M
Chr PAV_r1.0chr3
Pos (Chr) 15068989
PAV_r1.0 Pav_sc0001862.1
Pos (PAV_r1.0) 38856
REF A
ALT C
SSR motif
Gene Name Pav_sc0001862.1_g070.1.mk
Annotation PREDICTED: heterogeneous nuclear ribonucleoprotein 1-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1483-6006A>C
Amino Acid
PCR Forward primer CTTTTCCTTTCCCCCTTCTG
Reverse primer ACCTAGAGGTGCAGCCAAGA
Product size 283
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/REF REF/ALT REF/ALT REF/ALT REF/REF


| Top |