Cherry SNP DataBase

SNP information

Name Pav_sc0001925.1_223806R
Chr PAV_r1.0chr6
Pos (Chr) 19043770
PAV_r1.0 Pav_sc0001925.1
Pos (PAV_r1.0) 223806
REF A
ALT G
SSR motif
Gene Name Pav_sc0001925.1_g450.1.mk
Annotation PREDICTED: RNA polymerase II C-terminal domain phosphatase-like 2 isoform X3
snpEff Effect missense_variant
Impact MODERATE
Codon c.1901A>G
Amino Acid p.Gln634Arg
PCR Forward primer TGAAAATGTCTCGGTGGTCA
Reverse primer GCTGCATCTTCGTCCAATTT
Product size 316
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT -/- REF/ALT -/- REF/ALT


| Top |