Cherry SNP DataBase

SNP information

Name Pav_sc0001953.1_13584K
Chr PAV_r1.0chr4
Pos (Chr) 7869483
PAV_r1.0 Pav_sc0001953.1
Pos (PAV_r1.0) 13584
REF G
ALT T
SSR motif
Gene Name Pav_sc0001953.1_g030.1.mk
Annotation PREDICTED: chaperonin 60 subunit alpha 2, chloroplastic isoform X2
snpEff Effect 5_prime_UTR_variant
Impact MODIFIER
Codon c.-769G>T
Amino Acid
PCR Forward primer AACCTTGTTCAGCCAGCAAT
Reverse primer GTAAGGCCTCCCTGCTTTCT
Product size 294
Enzymes for CAPS MboI
Exp. fragment size (REF) 294
Exp. fragment size (ALT) 172,122
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF ALT/ALT REF/ALT REF/REF REF/ALT REF/ALT REF/ALT


| Top |