Cherry SNP DataBase

SNP information

Name Pav_sc0001954.1_72500K
Chr PAV_r1.0chr2
Pos (Chr) 3647739
PAV_r1.0 Pav_sc0001954.1
Pos (PAV_r1.0) 72500
REF T
ALT G
SSR motif
Gene Name Pav_sc0001954.1_g150.1.mk
Annotation PREDICTED: mediator of RNA polymerase II transcription subunit 15a-like
snpEff Effect missense_variant
Impact MODERATE
Codon c.1961A>C
Amino Acid p.Gln654Pro
PCR Forward primer GCAACCAAAGGAACCAAAGA
Reverse primer AAGCAAGAACTTCGAAGGCA
Product size 272
Enzymes for CAPS MspI
Exp. fragment size (REF) 272
Exp. fragment size (ALT) 194,78
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/REF REF/ALT REF/ALT REF/ALT REF/REF


| Top |