Cherry SNP DataBase

SNP information

Name Pav_sc0001954.1_78488R
Chr PAV_r1.0chr2
Pos (Chr) 3641751
PAV_r1.0 Pav_sc0001954.1
Pos (PAV_r1.0) 78488
REF G
ALT A
SSR motif
Gene Name Pav_sc0001954.1_g150.1.mk
Annotation PREDICTED: mediator of RNA polymerase II transcription subunit 15a-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.-12-782C>T
Amino Acid
PCR Forward primer CTCACCCAAGCTCAGCCTAA
Reverse primer AAACTCGATATGGAGCCCGT
Product size 324
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/ALT REF/ALT REF/REF


| Top |