Cherry SNP DataBase

SNP information

Name Pav_sc0002057.1_88402K
Chr PAV_r1.0chr1
Pos (Chr) 10441116
PAV_r1.0 Pav_sc0002057.1
Pos (PAV_r1.0) 88402
REF T
ALT G
SSR motif
Gene Name Pav_sc0002057.1_g100.1.mk
Annotation PREDICTED: uncharacterized protein LOC103322777
snpEff Effect missense_variant
Impact MODERATE
Codon c.2866A>C
Amino Acid p.Lys956Gln
PCR Forward primer ACATCAGCAGCAAAACACCA
Reverse primer GGGGAGAAAAACATGTCCCT
Product size 295
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/ALT REF/REF REF/REF


| Top |