Cherry SNP DataBase

SNP information

Name Pav_sc0002118.1_52827S
Chr PAV_r1.0chr7
Pos (Chr) 7521317
PAV_r1.0 Pav_sc0002118.1
Pos (PAV_r1.0) 52827
REF G
ALT C
SSR motif
Gene Name Pav_sc0002118.1_g080.1.mk
Annotation PREDICTED: uncharacterized serine-rich protein C215.13
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1890-727G>C
Amino Acid
PCR Forward primer TTGTGCCCCAAAAGCTTAAC
Reverse primer CTGCATAATGGAGTCAGCGA
Product size 342
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/ALT ALT/ALT REF/REF REF/ALT REF/ALT


| Top |