Cherry SNP DataBase

SNP information

Name Pav_sc0002176.1_34822K
Chr PAV_r1.0chr7
Pos (Chr) 8529427
PAV_r1.0 Pav_sc0002176.1
Pos (PAV_r1.0) 34822
REF G
ALT T
SSR motif
Gene Name Pav_sc0002176.1_g100.1.mk
Annotation PREDICTED: RING-H2 finger protein ATL70
snpEff Effect synonymous_variant
Impact LOW
Codon c.348G>T
Amino Acid p.Arg116Arg
PCR Forward primer ATCCACCTGACCTGCAAAAC
Reverse primer GTCGACAGAGGTGTTGGGAT
Product size 280
Enzymes for CAPS MspI
Exp. fragment size (REF) 164,10,106
Exp. fragment size (ALT) 174,106
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/ALT REF/REF REF/REF REF/REF REF/ALT


| Top |