Cherry SNP DataBase

SNP information

Name Pav_sc0002198.1_109923M
Chr PAV_r1.0chr8
Pos (Chr) 17526118
PAV_r1.0 Pav_sc0002198.1
Pos (PAV_r1.0) 109923
REF C
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.109923C>A
Amino Acid
PCR Forward primer ATTCTCGAGCTACAAGCCCC
Reverse primer GACACTCCAACCCCTTTTCA
Product size 280
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/ALT REF/ALT ALT/ALT ALT/ALT REF/ALT


| Top |