Cherry SNP DataBase

SNP information

Name Pav_sc0002266.1_33594R
Chr PAV_r1.0chr2
Pos (Chr) 11455347
PAV_r1.0 Pav_sc0002266.1
Pos (PAV_r1.0) 33594
REF G
ALT A
SSR motif
Gene Name Pav_sc0002266.1_g090.1.mk
Annotation PREDICTED: protein ECERIFERUM 1-like isoform X2
snpEff Effect intron_variant
Impact MODIFIER
Codon c.9+595C>T
Amino Acid
PCR Forward primer ATTTGGTCATCCCTGCAGTC
Reverse primer TCGAACAGGTCGACAGAGAA
Product size 245
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/REF REF/ALT REF/REF


| Top |