Cherry SNP DataBase

SNP information

Name Pav_sc0002266.1_43823K
Chr PAV_r1.0chr2
Pos (Chr) 11465576
PAV_r1.0 Pav_sc0002266.1
Pos (PAV_r1.0) 43823
REF T
ALT G
SSR motif
Gene Name Pav_sc0002266.1_g100.1.mk
Annotation hypothetical protein PRUPE_ppa004029mg
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1237-22A>C
Amino Acid
PCR Forward primer TTGGAATCGAGGTTGGAAAG
Reverse primer GGTGCCTCGAGGTAGTTGAG
Product size 282
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/ALT REF/ALT REF/REF


| Top |