Cherry SNP DataBase

SNP information

Name Pav_sc0002266.1_45101R
Chr PAV_r1.0chr2
Pos (Chr) 11466854
PAV_r1.0 Pav_sc0002266.1
Pos (PAV_r1.0) 45101
REF G
ALT A
SSR motif
Gene Name Pav_sc0002266.1_g100.1.mk
Annotation hypothetical protein PRUPE_ppa004029mg
snpEff Effect synonymous_variant
Impact LOW
Codon c.660C>T
Amino Acid p.Ser220Ser
PCR Forward primer TGTAATGCCTCTGCATGCTT
Reverse primer TGATCGGCATACCTGTAAAGTG
Product size 311
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/ALT REF/ALT REF/REF


| Top |