Cherry SNP DataBase

SNP information

Name Pav_sc0002318.1_156717S
Chr PAV_r1.0chr6
Pos (Chr) 20409951
PAV_r1.0 Pav_sc0002318.1
Pos (PAV_r1.0) 156717
REF G
ALT C
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.156717G>C
Amino Acid
PCR Forward primer TTCGGCCAATGTATTGAAAA
Reverse primer ATGGGATCACAAATGGGAAA
Product size 322
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/ALT REF/ALT REF/ALT


| Top |