Cherry SNP DataBase

SNP information

Name Pav_sc0002327.1_320902S
Chr PAV_r1.0chr1
Pos (Chr) 42705700
PAV_r1.0 Pav_sc0002327.1
Pos (PAV_r1.0) 320902
REF G
ALT C
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.320902G>C
Amino Acid
PCR Forward primer AGTTGTTGGATCAAAGCCCA
Reverse primer TGCATGCTAAAAGTGACATGG
Product size 330
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |