Cherry SNP DataBase

SNP information

Name Pav_sc0002327.1_406072M
Chr PAV_r1.0chr1
Pos (Chr) 42620530
PAV_r1.0 Pav_sc0002327.1
Pos (PAV_r1.0) 406072
REF A
ALT C
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.406072A>C
Amino Acid
PCR Forward primer TGGATGGAAAATTGGATGATG
Reverse primer ATGCCAAAACTTCCAAGCTC
Product size 348
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/REF -/- REF/REF REF/ALT REF/REF


| Top |