Cherry SNP DataBase

SNP information

Name Pav_sc0002342.1_21723Y
Chr PAV_r1.0chr6
Pos (Chr) 3682418
PAV_r1.0 Pav_sc0002342.1
Pos (PAV_r1.0) 21723
REF C
ALT T
SSR motif
Gene Name Pav_sc0002342.1_g040.1.br
Annotation hypothetical protein POPTR_0001s05240g
snpEff Effect missense_variant
Impact MODERATE
Codon c.718G>A
Amino Acid p.Asp240Asn
PCR Forward primer CCGCTGTACACATCAGTTGG
Reverse primer TTACAACACCAGGACAGCCA
Product size 283
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/ALT REF/REF REF/REF


| Top |