Cherry SNP DataBase

SNP information

Name Pav_sc0002355.1_10413R
Chr PAV_r1.0chr0
Pos (Chr) 49590092
PAV_r1.0 Pav_sc0002355.1
Pos (PAV_r1.0) 10413
REF G
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.10413G>A
Amino Acid
PCR Forward primer CAAGGCCACAATTTCAACAA
Reverse primer CTGTTTGTGGCTGTGATGCT
Product size 324
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
-/- REF/REF REF/REF REF/ALT -/- ALT/ALT REF/REF


| Top |