Cherry SNP DataBase

SNP information

Name Pav_sc0002360.1_189846R
Chr PAV_r1.0chr3
Pos (Chr) 17354041
PAV_r1.0 Pav_sc0002360.1
Pos (PAV_r1.0) 189846
REF A
ALT G
SSR motif
Gene Name Pav_sc0002360.1_g350.1.br
Annotation
snpEff Effect missense_variant
Impact MODERATE
Codon c.89T>C
Amino Acid p.Val30Ala
PCR Forward primer CCAGAGTTCAGGCCACTGAT
Reverse primer ATCGAACACCAAAATCGGAC
Product size 315
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/REF REF/REF REF/ALT REF/ALT REF/REF


| Top |