Cherry SNP DataBase

SNP information

Name Pav_sc0002456.1_20896W
Chr PAV_r1.0chr1
Pos (Chr) 43057497
PAV_r1.0 Pav_sc0002456.1
Pos (PAV_r1.0) 20896
REF T
ALT A
SSR motif
Gene Name Pav_sc0002456.1_g040.1.mk
Annotation PREDICTED: BEACH domain-containing protein lvsC
snpEff Effect 3_prime_UTR_variant
Impact MODIFIER
Codon c.*48A>T
Amino Acid
PCR Forward primer TGCCAAGGCATAATTCATCA
Reverse primer TCGCAAAGCTAACCTTCCTC
Product size 323
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |