Cherry SNP DataBase

SNP information

Name Pav_sc0002474.1_27650S
Chr PAV_r1.0chr2
Pos (Chr) 1414182
PAV_r1.0 Pav_sc0002474.1
Pos (PAV_r1.0) 27650
REF G
ALT C
SSR motif
Gene Name Pav_sc0002474.1_g100.1.mk
Annotation PREDICTED: E3 ubiquitin-protein ligase SINAT5-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.210+797G>C
Amino Acid
PCR Forward primer GACCCTGTTAGGATAGTGGGC
Reverse primer AACAGTTGTGGGTAGCAGGG
Product size 343
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/ALT REF/REF REF/REF REF/ALT REF/REF


| Top |