Cherry SNP DataBase

SNP information

Name Pav_sc0002567.1_5998R
Chr PAV_r1.0chr3
Pos (Chr) 12653447
PAV_r1.0 Pav_sc0002567.1
Pos (PAV_r1.0) 5998
REF G
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.5998G>A
Amino Acid
PCR Forward primer GCACCAGAAGTGCAAAGACA
Reverse primer CTGCCAACCTCTCCATTGAT
Product size 299
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT ALT/ALT REF/REF REF/ALT REF/ALT REF/ALT


| Top |