Cherry SNP DataBase

SNP information

Name Pav_sc0002574.1_100044K
Chr PAV_r1.0chr2
Pos (Chr) 20805011
PAV_r1.0 Pav_sc0002574.1
Pos (PAV_r1.0) 100044
REF G
ALT T
SSR motif
Gene Name Pav_sc0002574.1_g210.1.mk
Annotation PREDICTED: syntaxin-31
snpEff Effect intron_variant
Impact MODIFIER
Codon c.221-19G>T
Amino Acid
PCR Forward primer TGCATTGCCTAAAATTTTGCT
Reverse primer TTCAAGTCATCACAGACGGC
Product size 341
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/ALT REF/ALT REF/ALT REF/REF REF/ALT


| Top |