Cherry SNP DataBase

SNP information

Name Pav_sc0002574.1_73350K
Chr PAV_r1.0chr2
Pos (Chr) 20778317
PAV_r1.0 Pav_sc0002574.1
Pos (PAV_r1.0) 73350
REF T
ALT G
SSR motif
Gene Name Pav_sc0002574.1_g160.1.mk
Annotation PREDICTED: eukaryotic translation initiation factor 3 subunit F
snpEff Effect intron_variant
Impact MODIFIER
Codon c.536-248A>C
Amino Acid
PCR Forward primer TGATGAGAAAAGCACATCGC
Reverse primer TCAAGCATTGCGATCTGAAC
Product size 348
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/ALT REF/REF ALT/ALT REF/REF


| Top |