Cherry SNP DataBase

SNP information

Name Pav_sc0002632.1_4043K
Chr PAV_r1.0chr0
Pos (Chr) 53805114
PAV_r1.0 Pav_sc0002632.1
Pos (PAV_r1.0) 4043
REF G
ALT T
SSR motif
Gene Name Pav_sc0002632.1_g010.1.mk
Annotation PREDICTED: cysteine-rich receptor-like protein kinase 2
snpEff Effect missense_variant
Impact MODERATE
Codon c.199C>A
Amino Acid p.Leu67Ile
PCR Forward primer GACCAGGGTGTACCTGAGGA
Reverse primer GTGCAGGTGGAGTTGTCTGA
Product size 349
Enzymes for CAPS AluI | MboI
Exp. fragment size (REF) 110,94,145 | 300,27,22
Exp. fragment size (ALT) 110,239 | 201,99,27,22
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF ALT/ALT REF/ALT REF/ALT REF/ALT REF/ALT


| Top |