Cherry SNP DataBase

SNP information

Name Pav_sc0002817.1_44324K
Chr PAV_r1.0chr2
Pos (Chr) 5265357
PAV_r1.0 Pav_sc0002817.1
Pos (PAV_r1.0) 44324
REF G
ALT T
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.44324G>T
Amino Acid
PCR Forward primer ACCATCGTTCCATTGCTTTC
Reverse primer ACCTGAATTCTGAACCACGG
Product size 316
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
-/- REF/REF -/- REF/ALT ALT/ALT -/- REF/REF


| Top |