Cherry SNP DataBase

SNP information

Name Pav_sc0002817.1_44349M
Chr PAV_r1.0chr2
Pos (Chr) 5265382
PAV_r1.0 Pav_sc0002817.1
Pos (PAV_r1.0) 44349
REF A
ALT C
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.44349A>C
Amino Acid
PCR Forward primer ACCATCGTTCCATTGCTTTC
Reverse primer ACCTGAATTCTGAACCACGG
Product size 316
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF ALT/ALT REF/ALT ALT/ALT -/- REF/ALT


| Top |