Cherry SNP DataBase

SNP information

Name Pav_sc0002862.1_80214M
Chr PAV_r1.0chr5
Pos (Chr) 7334402
PAV_r1.0 Pav_sc0002862.1
Pos (PAV_r1.0) 80214
REF A
ALT C
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.80214A>C
Amino Acid
PCR Forward primer CTTGGAGCCTTGTACCCAAA
Reverse primer TACTGATGCGTTCCACCAAA
Product size 296
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT ALT/ALT ALT/ALT REF/ALT


| Top |