Cherry SNP DataBase

SNP information

Name Pav_sc0002870.1_33030Y
Chr PAV_r1.0chr1
Pos (Chr) 16235289
PAV_r1.0 Pav_sc0002870.1
Pos (PAV_r1.0) 33030
REF T
ALT C
SSR motif
Gene Name Pav_sc0002870.1_g070.1.mk
Annotation PREDICTED: helicase SEN1-like
snpEff Effect synonymous_variant
Impact LOW
Codon c.657A>G
Amino Acid p.Gln219Gln
PCR Forward primer GCCGTAACTTCTAACACGGC
Reverse primer TGCACAACCTGTTTTTCCAA
Product size 275
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |