Cherry SNP DataBase

SNP information

Name Pav_sc0002914.1_2339Y
Chr PAV_r1.0chr6
Pos (Chr) 13274636
PAV_r1.0 Pav_sc0002914.1
Pos (PAV_r1.0) 2339
REF C
ALT T
SSR motif
Gene Name Pav_sc0002914.1_g010.1.mk
Annotation PREDICTED: ribosome biogenesis protein TSR3 homolog
snpEff Effect intron_variant
Impact MODIFIER
Codon c.336-188C>T
Amino Acid
PCR Forward primer CAGTGCAATCTGTCATGCCT
Reverse primer CTGTCGGCCCAAATAAAGAA
Product size 275
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/REF REF/ALT REF/REF REF/ALT


| Top |