Cherry SNP DataBase

SNP information

Name Pav_sc0003087.1_11459K
Chr PAV_r1.0chr2
Pos (Chr) 281120
PAV_r1.0 Pav_sc0003087.1
Pos (PAV_r1.0) 11459
REF T
ALT G
SSR motif
Gene Name Pav_sc0003087.1_g030.1.br
Annotation PREDICTED: uncharacterized protein LOC103929856
snpEff Effect missense_variant
Impact MODERATE
Codon c.430A>C
Amino Acid p.Lys144Gln
PCR Forward primer ATGTTGTTCCCTAGCAACCG
Reverse primer ACGCTGCTGATCTTTTGGTT
Product size 301
Enzymes for CAPS MboI
Exp. fragment size (REF) 289,12
Exp. fragment size (ALT) 149,140,12
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/ALT REF/REF REF/REF REF/ALT


| Top |