Cherry SNP DataBase

SNP information

Name Pav_sc0003148.1_7878Y
Chr PAV_r1.0chr4
Pos (Chr) 11639902
PAV_r1.0 Pav_sc0003148.1
Pos (PAV_r1.0) 7878
REF T
ALT C
SSR motif
Gene Name Pav_sc0003148.1_g050.1.br
Annotation PREDICTED: BAHD acyltransferase At5g47980-like
snpEff Effect synonymous_variant
Impact LOW
Codon c.339A>G
Amino Acid p.Ser113Ser
PCR Forward primer AATTGCCAATCCACCACATT
Reverse primer ATAATGCCTCGATCACCTGC
Product size 203
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/ALT REF/REF REF/REF REF/REF


| Top |