Cherry SNP DataBase

SNP information

Name Pav_sc0003201.1_9684W
Chr PAV_r1.0chr7
Pos (Chr) 8820526
PAV_r1.0 Pav_sc0003201.1
Pos (PAV_r1.0) 9684
REF T
ALT A
SSR motif
Gene Name Pav_sc0003201.1_g020.1.br
Annotation PREDICTED: G-type lectin S-receptor-like serine/threonine-protein kinase RLK1
snpEff Effect missense_variant
Impact MODERATE
Codon c.137T>A
Amino Acid p.Ile46Asn
PCR Forward primer TCGATTGGCAGAACAAGTCA
Reverse primer GTTCGCATCTGGTCGATTTT
Product size 323
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/ALT ALT/ALT -/- REF/REF


| Top |