Cherry SNP DataBase

SNP information

Name Pav_sc0003326.1_90192W
Chr PAV_r1.0chr3
Pos (Chr) 7581427
PAV_r1.0 Pav_sc0003326.1
Pos (PAV_r1.0) 90192
REF A
ALT T
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.90192A>T
Amino Acid
PCR Forward primer ACGAAATCGTTGCATCCTTC
Reverse primer TTCGACAGCCTTAACCGAGT
Product size 300
Enzymes for CAPS DraI
Exp. fragment size (REF) 73,227
Exp. fragment size (ALT) 74,226
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/ALT REF/ALT REF/REF


| Top |